انت هنا الان : شبكة جامعة بابل > موقع الكلية > نظام التعليم الالكتروني > مشاهدة المحاضرة

lec10

Share |
الكلية كلية العلوم للبنات     القسم قسم فيزياء الليزر     المرحلة 7
أستاذ المادة اسراء عدنان ابراهيم البغدادي       20/06/2017 08:31:33
Transgenic plants and animals
The production of a transgenic organism involves altering the
genome so that a permanent change is effected. This is different from
somatic cell gene therapy, in which the effects of the transgene are
restricted to the individual who receives the treatment. In fact, the
whole point of generating a transgenic organism is to alter the germ
line so that the genetic change is inherited in a stable pattern fol-
lowing reproduction. This is one area of genetic engineering that has
caused great public concern, and there are many complex issues sur-
rounding the development and use of transgenic organisms. In addi-
tion, the scienti?c and technical problems associated with genetic
engineering in higher organisms are often dif?cult to overcome. This
is partly due to the size and complexity of the genome, and partly
due to the fact that the development of plants and animals is an
extremely complex process that is still not yet fully understood at
the molecular level. Despite these dif?culties, methods for the gener-
ation of transgenic plants and animals are now well established, and
the technology has already had a major impact in a range of differ-
ent disciplines. In this chapter we will consider some aspects of the
development and use of transgenic organisms.
13.1 Transgenic plants
All life on earth is dependent on the photosynthetic ?xation of car-
bon dioxide by plants. We sometimes lose sight of this fact, as most
people are removed from the actual process of generating our food,
It is often easy to forget that we
are dependent on the
photosynthetic reaction for our
foods, and plants are therefore
the most important part of our
food supply chain.
and the supermarket shelves have all sorts of exotic processed foods
and pre-prepared meals that seem to swamp the vegetable section.
Despite this, the generation of transgenic plants, particularly in the
context of genetically modified foods, has produced an enormous
public reaction to an extent that no one could have predicted. We
will return to this aspect of the debate in Chapter 15. In this section,
we will look at the science of transgenic plant production.258 GENETIC ENGINEERING IN ACTION
13.1.1 Why transgenic plants?
For thousands of years humans have manipulated the genetic char-
acteristics of plants by selective breeding. This approach has been
extremely successful and will continue to play a major part in agricul-
ture. However, classical plant breeding programmes rely on being able
to carry out genetic crosses between individual plants. Such plants
must be sexually compatible (which usually means that they have to
be closely related); thus, it has not been possible to combine genetic
traits from widely differing species. The advent of genetic engineering
has removed this constraint and has given the agricultural scientist
a very powerful way of incorporating de?ned genetic changes into
plants. Such changes are often aimed at improving the productivity
and ‘ef?ciency’ of crop plants, both of which are important to help
feed and clothe the increasing world population.
There are many diverse areas of plant genetics, biochemistry,
physiology, and pathology involved in the genetic manipulation of
plants. Some of the prime targets for the improvement of crop plants
are listed in Table 13.1. In many of these, success has already been
In agriculture, several aspects of
plant growth are potential
targets for improvement, either
by traditional plant breeding
methods or by gene
manipulation.
achieved to some extent. However, many people are concerned about
the possible ecological effects of the release of genetically modified
organisms (GMOs) into the environment, and there is much debate
about this aspect. The truth of the matter is that we simply do not
know what the long-term consequences might be -- a very small alter-
ation to the balance of an ecosystem, caused by a more vigorous or
disease-resistant plant, might have a considerable knock-on effect over
an extended time scale.
There are two main requirements for the successful genetic manip-
ulation of plants: (1) a method for introducing the manipulated gene
into the target plant and (2) a detailed knowledge of the molecu-
lar genetics of the system that is being manipulated. In many cases
the latter is the limiting factor, particularly where the characteristic
under study involves many genes (a polygenic trait). However, despite
the problems, plant genetic manipulation is already having a consid-
erable impact on agriculture.
13.1.2 Ti plasmids as vectors for plant cells
Introducing cloned DNA into plant cells is now routine practice in
many laboratories worldwide. A number of methods can be used to
achieve this, including physical methods such as microinjection or
biolistic DNA delivery. Alternatively a biological method can be used
The Agrobacterium Ti
plasmid-based vector is the most
commonly used system for the
introduction of recombinant
DNA into plant cells.
in which the cloned DNA is incorporated into the plant by a vector.
Although plant viruses such as calumoviruses or geminiviruses may
be attractive candidates for use as vectors, there are several problems
with these systems. Currently the most widely used plant cell vectors
are based on the Ti plasmid of
Agrobacterium tumefaciens
, which
is a soil bacterium that is responsible for crown gall disease. The
bacterium infects the plant through a wound in the stem, and a
tumour of cancerous tissue develops at the crown of the plant.TRANSGENIC PLANTS AND ANIMALS 259
Table 13.1. Possible targets for crop plant improvement
Target Bene?ts
Resistance to:
Diseases
Herbicides
Insects
Viruses
Improve productivity of crops and reduce
losses due to biological agents
Tolerance of:
Cold
Drought
Salt
Permit growth of crops in areas that are
physically unsuitable at present
Reduction of
photorespiration
Increase ef?ciency of energy conversion
Nitrogen ?xation Capacity to ?x atmospheric nitrogen
extended to a wider range of species
Nutritional value Improve nutritional value of storage
proteins by protein engineering
Storage properties Extend shelf-life of fruits and vegetables
Consumer appeal Make fruits and vegetables more appealing
with respect to colour, size, shape, etc.
The agent responsible for the formation of the crown gall tumour
is not the bacterium itself, but a plasmid known as the Ti plasmid (Ti
stands for tumour-inducing). Ti plasmids are large, with a size range
in the region of 140 to 235 kb. In addition to the genes responsi-
ble for tumour formation, the Ti plasmids carry genes for virulence
functions and for the synthesis and utilisation of unusual amino acid
derivatives known as opines. Two main types of opine are commonly
found, these being octopine and nopaline, and Ti plasmids can be
characterised on this basis. A map of a nopaline Ti plasmid is shown
in Fig. 13.1.
The region of the Ti plasmids responsible for tumour formation
is known as the T-DNA. This is some 15--30 kb in size and also car-
ries the gene for octopine or nopaline synthesis. On infection, the
T-DNA becomes integrated into the plant cell genome and is there-
fore a possible avenue for the introduction of foreign DNA into the
plant genome. Integration can occur at many different sites in the
plant genome, apparently at random. Nopaline T-DNA is a single seg-
ment, wheras octopine DNA is arranged as two regions known as the
left and right segments. The left segment is similar in structure to
nopaline T-DNA, and the right is not necessary for tumour forma-
tion. The structure of nopaline T-DNA is shown in Fig. 13.2. Genes for
tumour morphology are designated tms (‘shooty’ tumours), tmr (‘rooty’
tumours), and tml (‘large’ tumours). The gene for nopaline synthase
is designated nos (in octopine T-DNA this is ocs, encoding octopine260 GENETIC ENGINEERING IN ACTION
Nopaline
catabolism
p TiC58
CON
T-DNA
LB
vir
Agrocinopine
catabolism
RB
Fig. 13.1 Map of the nopaline plasmid pTiC58. Regions indicated are the T-DNA
(shaded), which is bordered by left and right repeat sequences (LB and RB), the genes
for nopaline and agrocinopine catabolism, and the genes specifying virulence (vir). The
CON region is responsible for conjugative transfer. From Old and Primrose (1989),
Principles of Gene Manipulation, Blackwell. Reproduced with permission.
synthase). The nos and ocs genes are eukaryotic in character, and their
promoters have been used widely in the construction of vectors that
express cloned sequences.
Ti plasmids are too large to be used directly as vectors, so smaller
Ti plasmids are too large to be
directly useful, and so they have
been manipulated to have the
desired characteristics of a good
cloning vehicle.
vectors have been constructed that are suitable for manipulation
in vitro. These vectors do not contain all the genes required for Ti-
mediated gene transfer and, thus, have to be used in conjunction
with other plasmids to enable the cloned DNA to become integrated
Fig. 13.2 Map of the nopaline T-DNA region. The left and right borders are indicated
by LB and RB. Genes for nopaline synthase (nos) and tumour morphology (tms, tmr, and
tml) are shown. The transcript map is shown below the T-DNA map. Transcripts 1 and 2
(tms) are involved in auxin production, transcript 4 (tmr) in cytokinin production. These
specify either shooty or rooty tumours. Transcript 3 encodes nopaline synthase, and
transcripts 5 and 6 encode products that appear to supress differentiation. From Old and
Primrose (1989), Principles of Gene Manipulation, Blackwell. Reproduced with permission.TRANSGENIC PLANTS AND ANIMALS 261
Fig. 13.3 Formation of a cointegrate Ti plasmid. Plasmid pGV3850 carries the vir genes
but has had some of the T-DNA region replaced with pBR322 sequences (pBR). The left
and right borders of the T-DNA are present (?lled regions). An insert (shaded) cloned
into a pBR322-based plasmid can be inserted into pGV3850 by homologous
recombination between the pBR regions, producing a disarmed cointegrate vector.
into the plant cell genome. Often a tripartite or triparental cross
is required, where the recombinant is present in one E. coli strain
and a conjugation-pro?cient plasmid in another. A Ti plasmid deriva-
tive is present in A. tumefaciens. When the three strains are mixed,
the conjugation-pro?cient ‘helper’ plasmid transfers to the strain car-
rying the recombinant plasmid, which is then mobilised and trans-
ferred to the Agrobacterium. Recombination then permits integration
of the cloned DNA into the Ti plasmid, which can transfer this DNA
to the plant genome on infection.
13.1.3 Making transgenic plants
In the development of transgenic plant methodology, two approaches
using Ti-based plasmids were devised: (1) cointegration and (2) the
binary vector system. In the cointegration method, a plasmid based
on pBR322 is used to clone the gene of interest (Fig. 13.3). This plasmid
is then integrated into a Ti-based vector such as pGV3850. This carries
the vir region (which speci?es virulence) and has the left and right
borders of T-DNA, which are important for integration of the T-DNA
region. However, most of the T-DNA has been replaced by a pBR322
sequence, which permits incorporation of the recombinant plasmid
by homologous recombination. This generates a large plasmid that
can facilitate integration of the cloned DNA sequence. Removal of
the T-DNA has another important consequence, as cells infected with
such constructs do not produce tumours and are subsequently much
easier to regenerate into plants by tissue culture techniques. Ti-based
plasmids lacking tumourigenic functions are known as disarmed vec-
tors.262 GENETIC ENGINEERING IN ACTION
Kan r
Bin 19
lacZ?
neo
pAL4404
Trans complementation
vir
MCS
Fig. 13.4 Binary vector system based on Bin 19. The Bin 19 plasmid carries the gene
sequence for the ?-peptide of ?-galactosidase (lacZ

), downstream from a polylinker
(MCS) into which DNA can be cloned. The polylinker/lacZ

/neo region is ?anked by the
T-DNA border sequences (?lled regions). In addition genes for neomycin
phosphotransferase (neo) and kanamycin resistance (Kan
r
) can be used as selectable
markers. The plasmid is used in conjunction with pAL4404, which carries the vir genes
but has no T-DNA. The two plasmids complement each other in trans to enable transfer
of the cloned DNA into the plant genome. From Old and Primrose (1989), Principles of
Gene Manipulation, Blackwell. Reproduced with permission.
The binary vector system uses separate plasmids to supply the
disarmed T-DNA (mini-Ti plasmids) and the virulence functions. The
mini-Ti plasmid is transferred to a strain of A. tumefaciens (which con-
tains a compatible plasmid with the vir genes) by a triparental cross.
Genes cloned into mini-Ti plasmids are incorporated into the plant
cell genome by trans complementation, where the vir functions are
supplied by the second plasmid (Fig. 13.4).
When a suitable strain of A. tumefaciens has been generated, con-
taining a disarmed recombinant Ti-derived plasmid, infection of plant
The regeneration of a functional
and viable organism is a critical
part of generating a transgenic
plant and is often achieved using
leaf discs.
tissue can be carried out. This is often done using leaf discs, from
which plants can be regenerated easily, and many genes have been
transferred into plants by this method. The method is summarised
in Fig. 13.5. The one disadvantage of the Ti system is that it does not
normally infect monocotyledonous (monocot) plants such as cereals
and grasses. As many of the prime target crops are monocots, this
has hampered the development with these varieties. However, other
methods (such as direct introduction or the use of biolistics) can be
used to deliver recombinant DNA to the cells of monocots, thus avoid-
ing the problem.
13.1.4 Putting the technology to work
Transgenic plant technology has been used for a number of years,
with varying degrees of success. One of the major problems we have al-
ready mentioned has been the public acceptance of transgenic plants.
In fact, in some cases, this resistance from the public has been more ofTRANSGENIC PLANTS AND ANIMALS 263
Ti-plasmid T-DNA
gene of interest
recombinant
regenerate new plant
from leaf disc
transfer recombinant
to leaf discs
(a)
insert into Agrobacterium
(b)
isolate leaf discs
Fig. 13.5 Regeneration of transgenic plants from leaf discs. (a) The target gene is
cloned into a vector based on the Ti plasmid. The recombinant plasmid is used to
transform Agrobacterium tumefaciens (often a triparental cross is used as described in the
text). The bacterium is then used to infect plant cells that have been grown as disc
explants of leaf tissue, as shown in (b). The transgenic plant is regenerated from the leaf
disc by propagation on an appropriate tissue culture medium.
a problem than the actual science. Towards the end of 1999 the back-
lash against so-called ‘Frankenfoods’ had reached the point where
Public con?dence in and
acceptance of transgenic plants
has been a dif?cult area in
biotechnology, with many
different views and interests. A
rational and balanced debate is
important if the technology is
ultimately to be of widespread
value.
companies involved were being adversely affected, either directly by
way of action against ?eld trials or indirectly in that consumers were
not buying the transgenic products. We will examine this area in a
little more depth in Chapter 15.
One of the ?rst recombinant DNA experiments to be performed
with plants did not in fact produce transgenic plants at all but
involved the use of genetically modi?ed bacteria. In nature, ice often
forms at low temperatures by associating with proteins on the sur-
face of so-called ice-forming bacteria, which are associated with
many plant species. One of the most common ice-forming bacterial
species is
Pseudomonas syringae
. In the late 1970s and early 1980s
researchers removed the gene that is responsible for synthesising the
ice-forming protein, producing what became known as ice-minus bac-
teria. Plans to spray the ice-minus strain onto plants in ?eld trials
were ready by 1982, but approval for this ?rst deliberate release
experiment was delayed as the issue was debated. Finally, approval
was granted in 1987, and the ?eld trial took place. Some success was
achieved as the engineered bacteria reduced frost damage in the test
treatments.264 GENETIC ENGINEERING IN ACTION
The bacterium
Bacillus thuringiensis
has been used to produce
transgenic plants known as Bt plants. The bacterium produces toxic
crystals that kill caterpillar pests when they ingest the toxin. The
Bt plants, in which a bacterial
toxin is used to confer resistance
to caterpillar pests, have been
successfully established and are
grown commercially in many
countries.
bacterium itself has been used as an insecticide, sprayed directly onto
crops. However, the gene for toxin production has been isolated and
inserted into plants such as corn, cotton, soybean, and potato, with
the ?rst Bt crops planted in 1996. By 2000 over half of the soybean
crop in the USA was planted with Bt-engineered plants, although
there have been some problems with pests developing resistance to
the Bt toxin.
One concern that has been highlighted by the planting of Bt corn
is the potential risk to non-target species. In 1999 a report in Nature
suggested that larvae of the Monarch butter?y, widely distributed
in North America, could be harmed by exposure to Bt corn pollen,
even though the regulatory process involved in approving the Bt corn
has examined this possibility and found no signi?cant risk. Risk is
associated with both toxicity and exposure, and subsequent research
has demonstrated that exposure levels are likely to be too low to pose
a serious threat to the butter?y. However, the debate continues. This
example illustrates the need for more extensive research in this area,
if genetically modi?ed crops are to gain full public acceptance.
Herbicide resistance is one area where a lot of effort has been
directed. The theory is simple -- if plants can be made herbicide-
resistant, then weeds can be treated with a broad-spectrum herbicide
without the crop plant being affected. One of the most common her-
bicides is glyphosate, which is available commercially as Roundup TM
and Tumbleweed TM
. Glyphosate acts by inhibiting an amino acid
Herbicide resistance is an area
that has been exploited by plant
biotechnologists to engineer
plants that are resistant to
common herbicides that are
used to control weeds.
biosynthetic enzyme called 5-enolpyruvylshikimate-3-phosphate syn-
thase (EPSP synthase or EPSPS). Resistant plants have been produced
by either increasing the synthesis of EPSPS by incorporating extra
copies of the gene, or by using a bacterial EPSPS gene that is slightly
different from the plant version and produces a protein that is resis-
tant to the effects of glyphosate. Monsanto has produced various crop
plants, such as soya, that are called Roundup-ready, in that they are
resistant to the herbicide. Such plants are now used widely in the
USA and some other countries, and herbicide resistance is the most
commonly manipulated trait in genetically modi?ed (GM) plants.
Since the ?rst GM crops were planted commercially, there has been
a steady growth in the area of GM plantings worldwide. Fig. 13.6
shows the total area of GM crops planted from 1996 to 2006. Two
GM plants are now grown in
some 22 countries, with over
100 million hectares being
planted in 2006.
points are of interest here, in addition to the overall growth in area
year-on-year. First, the symbolically signi?cant 100 million hectare
barrier was broken in 2006. Second, the developing countries of the
world are embracing GM crop plants and are now catching up with
the industrialised countries. This is also evident from Table 13.2,
which shows data for areas planted in 2006 for each of the 22 coun-
tries growing GM crops commercially.
The four main GM crops are soybean, maize, cotton, and canola
(oilseed rape). Table 13.3 shows areas planted with GM varieties forTRANSGENIC PLANTS AND ANIMALS 265
0
20
40
60
80
120
Globas area planted (Mha)
100
1997
2005
Year
2003
1996
1998
1999
2001
2000
2002
2004
2006
Total area planted
Industrialised countries
Developing countries
Fig. 13.6 The total area of GM crops planted worldwide is shown for the period
1996–2006. Areas are in millions of hectares (MHa). For 1998, 2002, and 2006 the
balance between industrialised countries and developing countries is shown by the
shaded bars. Data from James (2006), ISAAA Brief 35. (See www.isaaa.org for further
information). Reproduced with permission.
each of these crops. The most commonly grown GM crop is soybean,
which made up around 59% of the total of GM crops planted in 2006.
In addition to the ‘big four’ GM crops, other plant species have of
course been genetically modi?ed, with one example being the tomato.
Tomatoes are usually picked green, so that they are able to withstand
shipping and transportation without bruising. They are then ripened
arti?cially by using ethylene gas, as ethylene is a key trigger for the
ripening process. In trying to delay natural ripening, two approaches
have been used. One is to target the production of ethylene itself,
thus delaying the onset of the normal ripening mechanism. A sec-
ond approach illustrates how a novel idea, utilising advanced gene
technology to achieve an elegant solution to a de?ned problem, can
still fail because of other considerations -- this is the story of the Flavr
Savr (sic) tomato.
The biotechnology company Calgene developed the Flavr Savr
tomato using what became known as antisense technology. In this
approach, a gene sequence is inserted in the opposite orientation, so
that on transcription an mRNA that is complementary to the normal
mRNA is produced. This antisense mRNA will therefore bind to the
normal mRNA in the cell, inhibiting its translation and effectively
shutting off expression of the gene. The principle of the method is266 GENETIC ENGINEERING IN ACTION
Table 13.2. Areas of GM crops planted in 2006 by
country
Country Total area planted (MHa)
Countries planting > 50000 Ha
USA 54.6
Argentina 18.0
Brazil 11.5
Canada 6.1
India 3.8
China 3.5
Paraguay 2.0
South Africa 1.4
Uruguay 0.4
Philippines 0.2
Australia 0.2
Romania 0.1
Mexico 0.1
Spain 0.1
Countries planting < 50000 Ha
Czech Republic –
France –
Germany –
Iran –
Slovakia –
Portugal –
Honduras –
Colombia
Note: Areas of GM crops planted by country.
Source: Data from James (2006), ISAAA Brief 35. (See www.isaaa.org
for further information). Reproduced with permission.
Table 13.3. The four main GM crops
Year 1998 2002 2006
MHa % MHa % MHa %
Soybean 14 (54) 36 (62) 59 (58)
Maize 8 (30) 12 (21) 25 (24)
Cotton 2 (8) 7 (12) 13 (13)
Canola
(oilseed rape)
2 (8) 3 (5) 5 (5)
Total 26 (100) 58 (100) 102 (100)
Note: Approximate areas of the four main GM crops (in MHa), and as a % of
the total GM crops grown, are shown for the years 1998, 2002, and 2006.
Source: Data from James (1998, 2002, 2006), ISAAA Briefs 8, 27, 35. (See
www.isaaa.org for further information.) Reproduced with permission.TRANSGENIC PLANTS AND ANIMALS 267
UUUACUAUCAUGCCCAUGUUU
AAAUGAUAGUACGGGUACAAA
5 -
3 -
- 3
- 5
sense mRNA
gene
antisense mRNA
gene inserted in
opposite orientation
mRNAs hybridise
(a) (b)
(c)
chromosome
Fig. 13.7 Antisense technology. The target gene is shown in (a). A copy of the gene is
introduced into a separate site on the genome, but in the opposite orientation, as shown
in (b). On transcription of the antisense gene, an antisense mRNA is produced. This
binds to the normal mRNA, preventing translation. Part of the sequence is shown in
(c) to illustrate.
shown in Fig. 13.7. In the Flavr Savr, the gene for the enzyme poly-
galacturonase (PG) is the target. This enzyme digests pectin in the
cell wall and leads to fruit softening and the onset of rotting. The
elegant theory is that inhibition of PG production should slow the
decay process and the fruit should be easier to handle and trans-
port after picking. It can also be left on the vine to mature longer
than is usually the case, thus improving ?avour. After much develop-
ment, the Flavr Savr became the ?rst genetically modi?ed food to be
approved for use in the USA, in 1994. The level of PG was reduced to
something like 1% of the normal levels, and the product seemed to
be set for commercial success. However, various problems with the
Sometimes an elegant and
well-designed scienti?c solution
to a particular problem does not
guarantee commercial success
for the produce, with many
factors having an impact on the
success or failure of a GM
product.
characteristics affecting growth and picking of the crop led to the
failure of the Flavr Savr in commercial terms. Calgene is now part of
Monsanto, having been stretched too far by development of the Flavr
Savr. Despite the failure of the Flavr Savr, the company has contin-
ued to produce innovations in biotechnology, including rapeseed oil
(known as canola oil in the USA) with a high concentration of lauric
acid, which is bene?cial from a health perspective.
Attempts to improve the nutritional quality of crops are not
restricted to the commercial or healthfood sectors. For many millions
of people around the world, access to basic nutrition is a matter of
survival rather than choice. Rice is the staple food of some 3 billion
people, and about 10% of these suffer from health problems associ-
ated with vitamin A de?ciency. It is estimated that around 1 million
Rice is of such importance as a
staple food that it is an obvious
target for GM technologists.
children die prematurely from this de?ciency, with a further 350000
going blind. Thus, rice has been one of the most intensively studied
crop species with respect to improving quality of life for around half
of the world’s population. This led to the development of ‘Miracle
Rice’, which was a product of the green revolution of the 1960s. How-
ever, widespread planting throughout Southeast Asia led to a rice268 GENETIC ENGINEERING IN ACTION
monoculture, with increased susceptibility to disease and pests, and
the increased dependence on pesticides that this brings. Thus, as with
genetically modi?ed crops, there can be problems in adopting new
variants of established crop species.
There are two main nutritional de?ciency problems that are par-
ticularly prevalent in developing countries. These are iron deficiency
and vitamin A deficiency, both of which result from a lack of these
micronutrients in the diet. In rice, there is a low level of iron in the
endosperm. There are also problems with iron re-absorption due to
the presence of a chemical called phytate. Low levels of sulphur also
contribute to the dif?culties, as this is required for ef?cient absorp-
tion of iron in the intestine. The vitamin A problem is due to the
The development of ‘Golden
Rice’ is an example of good
science and good intent, although
as is often the case the political
agenda may have a role to play in
determining how bene?ts are
shared and distributed.
failure of rice to synthesise -carotene, which is required for the
biosynthesis of vitamin A. In 1999 Ingo Potrykus, working in Zurich,
succeeded in producing ‘Golden rice’ with -carotene in the grain
endosperm, where it is not normally found. As -carotene is a precur-
sor of vitamin A, increasing the amount available by engineering rice
in this way should help to alleviate some of the problems of vitamin
A de?ciency. This is obviously a positive development. However, corpo-
rate interests in patent rights to the technologies involved, and other
non-scienti?c problems, had to be sorted out before agreement was
reached that developing countries could access the technology freely.
Development work and legal wrangles continue, but once again it is
clear that it is dif?cult to strike a balance between commercial fac-
tors and the potential bene?ts of transgenic plant technology. This
is a particularly sensitive topic when those who would bene?t most
may not have the means to afford the technology, and again raises
some dif?cult ethical questions.
A further twist in the corporate vs. common good debate can
be seen in the so-called gene protection technology. This is where
companies design their systems so that their use can be controlled,
by some sort of manipulation that is essentially separate from the
actual transgenic technology that they are designed to deliver. This
has caused great concern among public and pressure groups, and a
vigorous debate has ensued between such groups and the companies
The development and
implementaion of protection
technologies is a highly
controversial and emotive area
of plant genetic manipulation,
with strong opinions on both
sides of the argument.
who are developing the technology. Even the terms used to describe
the various approaches re?ect the strongly held views of proponents
and opponents. Thus, one system is called a technology protection
system by the corporate sector, and terminator technology by others.
Another type of system is called genetic use restriction technology
(GURT) or genetic trait control technology; this is also known more
widely as traitor technology. So what do these emotive terms mean,
and is there any need for concern?
Terminator technology is where plants are engineered to produce
seeds that are essentially sterile, or do not germinate properly. Thus,
the growers are prevented from gathering seeds from one year to
plant the next season, and are effectively tied to the seed company,
as they have to buy new seeds each year. Companies reasonably claim
that they have to obtain returns on the considerable investmentTRANSGENIC PLANTS AND ANIMALS 269
required to develop a transgenic crop plant. Others, equally reason-
ably, insist that this constraint places poor farmers in developing
countries at a considerable disadvantage, as they are unable to save
seed from one year’s crop to develop the next season’s planting.
Approximately half of the world’s farmers are classed as ‘poor’ and
cannot afford to buy new seed each season. They produce around 20%
of world food output and feed some 1.4 billion people. Thus, there is
a major ethical issue surrounding the prevention of seed-collecting
from year to year, if terminator technology were to be applied widely.
There is also great concern that any sterility-generating technology
could transfer to other variants, species, or genera, thus having a
devastating effect on third-world farming communities.
Traitor technology or GURT involves the use of a ‘switch’ (often
controlled by a chemical additive) to permit or restrict a particular
engineered trait. This is perhaps a little less contentious than termi-
nator technology, as the aim is to regulate a particular modi?cation
rather than to prevent viable seed production. However, there are still
many who are very concerned about the potential uses of this tech-
nology, which could again tie growers to a particular company if the
‘switch’ requires technology that only that company can supply.
Some of the major agricultural biotechnology companies have
stated publicly that they will not develop terminator technology,
which is seen as a partial success for the negative reaction of the
public, farmers, and pressure groups. There is, however, still a lot
of uncertainty in this area, with some groups claiming that traitor
technology is being developed further, and that corporate mergers
can negate promises made previously by one of the partners in the
merger. The whole ?eld of transgenic plant technology is therefore in
some degree of turmoil, with many con?icting interests, views, and
personalities involved. The debates are set to continue for a long time
to come.
In addition to GM crops, transgenic plants also have the potential
to make a signi?cant impact on the biotechnology of therapeutic
protein production. As we saw in Chapter 11, bacteria, yeast, and
The use of plants as ‘factories’
for the synthesis of therapeutic
proteins is an area that is
currently being developed to
enable the production of
plant-made pharmaceuticals
(PMPs).
mammalian cells are commonly used for the production of high-
value proteins by recombinant DNA technology. An obvious extension
would be to use transgenic plants to produce such proteins. Plants are
cheap to grow compared to the high-cost requirements of microbial or
mammalian cells and, thus, cost reduction and potentially unlimited
scale-up opportunities make transgenic plants an attractive option for
producing high-value proteins. This is an area of active development
at the moment, and the term plant-made pharmaceuticals (PMPs) has
been coined to describe this aspect of transgenic plant technology.
13.2 Transgenic animals
The generation of transgenic animals is one of the most complex
aspects of genetic engineering, both in terms of technical dif?culty270 GENETIC ENGINEERING IN ACTION
and in the ethical problems that arise. Many people, who accept that
the genetic manipulation of bacterial, fungal, and plant species is
The debate around the use of
GM technology becomes even
more far-reaching when
transgenic animals are
concerned, and often raises
animal welfare issues as well as
the genetic modi?cation aspects
of the technology.
bene?cial, ?nd dif?culty in extending this acceptance when animals
(particularly mammals) are involved. The need for sympathetic and
objective discussion of this topic by the scienti?c community, the
media, and the general public are likely to present one of the great
challenges in scienti?c ethics over the next few years.
13.2.1 Why transgenic animals?
Genetic engineering has already had an enormous impact on the
study of gene structure and expression in animal cells, and this is
one area that will continue to develop. Cancer research is one obvious
example, and current investigation into the molecular genetics of the
disease requires extensive use of gene manipulation technology. In
the ?eld of protein production in biotechnology (discussed in Chapter
11), the synthesis of many mammalian-derived recombinant proteins
is often best carried out using cultured mammalian cells, as these
are sometimes the only hosts that will ensure the correct expression
of such genes.
Cell-based applications such as those outlined above are an impor-
tant part of genetic engineering in animals. However, the term ‘trans-
genic’ is usually reserved for whole organisms, and the generation of
The term ‘transgenic’ is mostly
used to describe whole
organisms that have been
modi?ed to contain transgenes
in a stable form that are
inherited by transmission
through the germ line.
a transgenic animal is much more complex than working with cul-
tured cells. Many of the problems have been overcome using a variety
of animals, with early work involving amphibians, ?sh, mice, pigs,
and sheep.
Transgenics can be used for a variety of purposes, covering both
basic research and biotechnological applications. The study of embry-
ological development has been extended by the ability to introduce
genes into eggs or early embryos, and there is scope for the manip-
ulation of farm animals by the incorporation of desirable traits via
transgenesis. The use of whole organisms for the production of recom-
binant protein is a further possibility, and this has already been
achieved in some species. The term pharm animal or pharming (from
pharmaceutical) is sometimes used when talking about the produc-
tion of high-value therapeutic proteins using transgenic animal tech-
nology.
When considered on a global scale, the potential for exploitation
of transgenic animals would appear to be almost unlimited. Achieving
that potential is likely to be a long and dif?cult process in many cases,
but the rewards are such that a considerable amount of money and
effort has already been invested in this area.
13.2.2 Producing transgenic animals
There are several possible routes for the introduction of genes into
embryos, each with its own advantages and disadvantages. Some
of the methods are (1) direct transfection or retroviral infection of
embryonic stem cells followed by introduction of these cells into
an embryo at the blastocyst stage of development; (2) retroviralTRANSGENIC PLANTS AND ANIMALS 271
infection of early embryos; (3) direct microinjection of DNA into
oocytes, zygotes, or early embryo cells; (4) sperm-mediated transfer;
(5) transfer into unfertilised ova; and (6) physical techniques such as
biolistics or electrofusion. In addition to these methods, the tech-
nique of nuclear transfer (used in organismal cloning, discussed in
Chapter 14) is sometimes associated with a transgenesis protocol.
Early success was achieved by injecting DNA into one of the pronu-
clei of a fertilised egg, just prior to the fusion of the pronuclei (which
produces the diploid zygote). This approach led to the production
of the celebrated ‘supermouse’ in the early 1980s, which represents
The production of ‘supermouse’
in the early 1980s represents one
of the milestone achievements in
genetic engineering. one of the milestones of genetic engineering. The experiments that
led to the ‘supermouse’ involved placing a copy of the rat growth
hormone (GH) gene under the control of the mouse metallothio-
nine (mMT) gene promoter. To create the ‘supermouse’, a linear frag-
ment of the recombinant plasmid carrying the fused gene sequences
(MGH) was injected into the male pronuclei of fertilised eggs (linear
fragments appear to integrate into the genome more readily than
circular sequences). The resulting fertilised eggs were implanted into
the uteri of foster mothers, and some of the mice resulting from this
expressed the GH gene. Such mice grew some 2--3 times faster than
control mice and were up to twice the size of the controls. Pronuclear
microinjection is summarised in Fig. 13.8.
In generating a transgenic animal, it is desirable that all the cells
in the organism receive the transgene. The presence of the transgene
in the germ cells of the organism will enable the gene to be passed on
to succeeding generations, and this is essential if the organism is to be
useful in the long term. Thus, introduction of genes has to be carried
out at a very early stage of development, ideally at the single-cell
zygote stage. If this cannot be achieved, there is the possibility that
Mosaics and chimaeras, where
not all the cells of the animal
carry the transgene, are
variations that can arise when
producing transgenic animals.
a mosaic embryo will develop, in which only some of the cells carry
the transgene. Another example of this type of variation is where the
embryo is generated from two distinct individuals, as is the case when
embryonic stem cells are used. This results in a chimaeric organism.
In practice this is not necessarily a problem, as the organism can be
crossed to produce offspring that are homozygous for the transgene in
all cells. A chimaeric organism that contains the transgene in its germ
line cells will pass the gene on to its offspring, which will therefore
be heterozygous for the transgene (assuming they have come from
a mating with a homozygous non-transgenic). A further cross with
a sibling will result in around 25% of the offspring being homozy-
gous for the transgene. This procedure is outlined for the mouse in
Fig. 13.9.
13.2.3 Applications of transgenic animal technology
Introduction of growth hormone genes into animal species has been
carried out, notably in pigs, but in many cases there are undesirable
side effects. Pigs with the bovine growth hormone gene show greater
feed ef?ciency and have lower levels of subcutaneous fat than normal
pigs. However, problems such as enlarged heart, high incidence of272 GENETIC ENGINEERING IN ACTION
(d)
implant into foster mother
DNA
male pronucleus
female pronucleus
MGH
+
(c)
(b)
(a) fertilised egg Fig. 13.8 Production of
‘supermouse’. (a) Fertilised eggs
were removed from a female and
(b) the DNA carrying the rat
growth hormone gene/mouse
metallothionein promoter
construct (MGH) was injected into
the male pronucleus. (c) The eggs
were then implanted into a foster
mother. (d) Some of the pups
expressed the MGH construct
(MGH
+
) and were larger than the
normal pups.
stomach ulcers, dermatitis, kidney disease, and arthritis have demon-
strated that the production of healthy transgenic farm animals is a
dif?cult undertaking. Although progress is being made, it is clear
that much more work is required before genetic engineering has a
major impact on animal husbandry.
The study of development is one area of transgenic research that
is currently yielding much useful information. By implanting genes
into embryos, features of development such as tissue-speci?c gene
expression can be investigated. The cloning of genes from the fruit
?y Drosophila melanogaster, coupled with the isolation and characteri-
sation of transposable elements (P elements) that can be used as vec-
tors, has enabled the production of stable transgenic Drosophila lines.
Thus, the fruit ?y, which has been a major contributor to the ?eld of
classical genetic analysis, is now being studied at the molecular level
by employing the full range of gene manipulation techniques.TRANSGENIC PLANTS AND ANIMALS 273
(a)
(b)
trophoblast
transgene
select cells containing
the transgene
remove embryonic
stem (ES) cells
ES cell
inject ES cells
into embryo
grow embryo
in utero
chimaeric mouse
produced
(c)
x x
(d)
heterozygous
transgenic mouse
homozygous
transgenic mouse
Fig. 13.9 Production of transgenic mice using embryonic stem cell technology.
(a) Embryonic stem cells (ES cells) are removed from an early embryo and cultured. The
target transgene is inserted into the ES cells, which are grown on selective media.
(b) The ES cells containing the transgene are injected into the ES cells of another
embryo, where they are incorporated into the cell mass. The embryo is implanted into a
pregnant mother, and a chimaeric transgenic mouse is produced. By crossing the
chimaera with a normal mouse as shown in (c), some heterozygous transgenics will be
produced. If they are then self-crossed, homozygous transgenics will be produced in
about 25% of the offspring, as shown in (d).
In mammals, the mouse is proving to be one of the most useful
model systems for investigating embryological development, and the
expression of many transgenes has been studied in this organism. One
such application is shown in Fig. 13.10, which demonstrates the use
of the lacZ gene as a means of detecting tissue-speci?c gene expres-
sion. In this example the lacZ gene was placed under the control of
The mouse has proved to be one
of the most useful model
organisms for transgenesis
research, with many different
variants having been produced
for a variety of purposes.
the weak thymidine kinase (TK) promoter from herpes simplex virus
(HSV), generating an HSV-TK--lacZ construct. This was used to probe for
active chromosomal domains in the developing embryos, with one
of the transgenic lines showing the brain-speci?c expression seen in
Fig. 13.10.
Although the use of transgenic organisms is providing many
insights into developmental processes, inserted genes may not always274 GENETIC ENGINEERING IN ACTION
Fig. 13.10 Expression of a transgene in the mouse embryo. The ?-galactosidase (lacZ)
coding region was placed under the control of a thymidine kinase promoter from herpes
simplex virus to produce the HSV-TK–lacZ gene construct. This was injected into male
pronuclei and transgenic mice were produced. The example shows a 13-day foetus from
a transgenic strain that expresses the transgene in brain tissue during gestation.
Detection is by the blue colouration produced by the action of ?-galactosidase on X-gal.
Thus, the dark areas in the fore- and hindbrain are regions where the lacZ gene has been
expressed. Photograph courtesy of Dr S. Hettle. From Allen et al. (1988), Nature
(London) 333, 852–855. Copyright (1988) Macmillan Magazines Limited. Reproduced with
permission.
be expressed in exactly the same way as would be the case in nor-
mal embryos. Thus, a good deal of caution is often required when
interpreting results. Despite this potential problem, transgenesis is
proving to be a powerful tool for the developmental biologist.
Mice have also been used widely as animal models for disease
states. One celebrated example is the oncomouse, generated by Philip
Leder and his colleagues at Harvard University. Mice were produced
in which the
c-myc
oncogene and sections of the mouse mammary
tumour (MMT) virus gave rise to breast cancer. The oncomouse has a
place in history as the ?rst complex animal to be granted a patent in
the USA. Other transgenic mice with disease characteristics include
the prostate mouse (prostate cancer), mice with severe combined
immunodeficiency syndrome (SCIDS), and mice that show symptoms
of Alzheimer disease.
Many new variants of transgenic mice have been produced and
have become an essential part of research into many aspects of
human disease. Increased knowledge of molecular genetics, and theTRANSGENIC PLANTS AND ANIMALS 275
continued development of the techniques of transgenic animal pro-
duction, have enabled mice to be generated in which speci?c genes
can be either activated or inactivated. Where a gene is inactivated or
replaced with a mutated version, a knockout mouse is produced. If
an additional gene function is established, this is sometimes called
a knockin mouse. The use of knockout mice in cystic ?brosis (CF)
research is one example of the technology being used in both basic
research and in developing gene therapy procedures. Mice have been
engineered to express mutant CF alleles, including the prevalent
F508 mutation that is responsible for most serious CF presentations.
Having a mouse model enables researchers to carry out experiments
that would not be possible in humans, although (as with developmen-
tal studies) results may not be exactly the same as would be the case
in a human subject.
In 1995 a database was established to collate details of knockout
mice. This is known as the Mouse Knockout and Mutation Database
There are over 5 000 entries in
the Mouse Knockout and
Mutation Database, which is a
major resource for those
interested in using the mouse as
a model system for the study of
gene expression, development,
and disease.
(MKMD) and can be found at [http://research.bmn.com/mkmd/]. At the
time of writing some 5 000 entries were listed, representing over 2 000
unique genes, with more being added daily. This demonstrates that
the mouse is proving to be one of the mainstays of modern transgenic
research.
Early examples of protein production in transgenic animals
include expression of human tissue plasminogen activator (TPA) in
transgenic mice, and of human blood coagulation factor IX (FIX)
in transgenic sheep. In both cases the transgene protein product was
secreted into the milk of lactating organisms by virtue of being placed
under the control of a milk-protein gene promoter. In the mouse
example the construct consisted of the regulatory sequences of the
whey acid protein (WAP) gene, giving a WAP--TPA construct. Control
sequences from the -lactoglobulin (BLG) gene were used to gener-
ate a BLG--FIX construct for expression in the transgenic sheep. Other
examples of transgenic animals acting as bioreactors include pigs that
express human haemoglobin, and cows that produce human lactofer-
rin.
Producing a therapeutic protein in milk provides an ideal way of
ensuring a reliable supply from lactating animals, and downstream
processing to obtain puri?ed protein is relatively straightforward. This
approach was used by scientists from the Roslin Institute near Edin-
burgh, working in conjunction with the biotechnology company PPL
Therapeutics. In 1991 PPL’s ?rst transgenic sheep (called Tracy) was
born. Yields of human proteins of around 40 g L
? 1 were produced
from milk, demonstrating the great potential for this technology. PPL
continues to develop a range of products, such as -1-antitrypsin (for
The use of transgenic animals as
producers of high-value products
is more fully developed than is
the case for transgenic plants,
although there are often
scienti?c and commercial
problems in making a success of
the technology.
treating CF), fibrinogen (for use in medical procedures), and human
factor IX (for haemophilia B).
Using animals as bioreactors offers an alternative to the fermenta-
tion of bacteria or yeast that contain the target gene. The technology
is now becoming well established, with many biotechnology compa-
nies involved. As we have already seen, this area is sometimes called276 GENETIC ENGINEERING IN ACTION
pharming, with the transgenic animals referred to as pharm animals.
Given the problems in achieving correct expression and processing of
some mammalian proteins in non-mammalian hosts, this is proving
to be an important development of transgenic animal technology.
As we saw in Chapter 11, good science does not necessarily lead to
a viable product, with many strategic and commercial aspects having
an impact on whether or not a product is developed fully to market.
One such case recently has been the potential use of chicken eggs to
produce anticancer therapeutics. In a collaboration among the Roslin
Institute, Oxford Biomedica, and Viragen, potentially useful proteins
have been produced in the whites of eggs laid by a transgenic hen.
Whilst the science is novel and impressive, the commercial aspects
of the project led to an announcement by Viragen in June 2007 that
it was not proceeding with further development of the system. Such
setbacks are not unusual, and although this might seem unfortu-
nate, the ?eld as a whole will continue to progress, with successful
commercially viable developments undoubtedly appearing more fre-
quently in the future as the industry becomes more mature.
Transgenic animals also offer the potential to develop organs for
xenotransplantation. The pig is the target species for this application,
as the organs are of similar size to human organs. In developing
this technology the key target is to alter the cell surface recognition
properties of the donor organs, so that the transplant is not rejected
The use of transgenic technology
to enable xenotransplantation is
an area that could alleviate some
of the problems of supply and
demand that exist in the ?eld of
organ transplantation.
by the human immune system. In addition to whole organs from
mature animals, there is the possibility of growing tissue replace-
ments as an additional part of a transgenic animal. Both these aspects
of xenotransplantation are currently being investigated, with a lot of
scienti?c and ethical problems still to be solved. Given the shortfall
in organ donors, and the consequent loss of life or quality of life that
results, many people feel that the objections to xenotransplantation
must be discussed openly, and overcome, to enable the technology to
be implemented when fully developed.


المادة المعروضة اعلاه هي مدخل الى المحاضرة المرفوعة بواسطة استاذ(ة) المادة . وقد تبدو لك غير متكاملة . حيث يضع استاذ المادة في بعض الاحيان فقط الجزء الاول من المحاضرة من اجل الاطلاع على ما ستقوم بتحميله لاحقا . في نظام التعليم الالكتروني نوفر هذه الخدمة لكي نبقيك على اطلاع حول محتوى الملف الذي ستقوم بتحميله .
download lecture file topic