انت هنا الان : شبكة جامعة بابل > موقع الكلية > نظام التعليم الالكتروني > مشاهدة المحاضرة

lec8

Share |
الكلية كلية العلوم للبنات     القسم قسم علوم الحياة     المرحلة 7
أستاذ المادة اسراء عدنان ابراهيم البغدادي       20/06/2017 08:28:05
medical and forensic
applications of gene
manipulation
the diagnosis and treatment of human disease is one area in which
genetic manipulation is beginning to have a considerable effect. as
outlined in chapter 11, many therapeutic proteins are now made
by recombinant dna (rdna) methods, and the number available is
increasing steadily. thus, the treatment of conditions by recombinant-
derived products is already well established. in this chapter we will
look at how the techniques of gene manipulation impact more
directly on medical diagnosis and treatment, and we will also exam-
ine the use of rdna technology in forensic science. recent progress
in both of these areas is of course closely linked to our increasing
knowledge of the human genome, and new developments in medical
and forensic applications will undoubtedly appear as we continue to
decipher the genome.
12.1 diagnosis and characterisation
of medical conditions
genetically based diseases (often called simply ‘genetic diseases’) rep-
resent one of the most important classes of disease, particularly in
children. a disorder present at birth is termed a congenital abnor-
mality, and around 5% of newborn babies will suffer from a serious
medical problem of this type. in most of these cases there will be a
signi?cant genetic component in the aetiology (cause) of the disease.
it is estimated that about a third of primary admissions to paediatric
hospitals are due to genetically based problems, whilst some 70% of
cases presenting more than once are due to genetic defects. in addi-
tion to genetic problems appearing at birth or in childhood, it seems
that a large proportion of diseases presenting in later life also have
a genetic cause or predisposition. thus, medical genetics, in its tradi-
tional non-recombinant form, has already had a major impact on the
as many disease conditions have
a major genetic component,
gene manipulation technology
has provided new tools for
investigating and treating what
are sometimes called ‘genetic
diseases’.
diagnosis of disease and abnormality. the development of molecular
genetics and rdna technology has not only broadened the range of
techniques available for diagnosis, but has also opened up the possi-
bility of novel gene-based treatments for certain conditions.228 genetic engineering in action
12.1.1 diagnosis of infection
in addition to genetic conditions that affect the individual, rdna
technology is also important in the diagnosis of certain types of
infection. normally, bacterial infection is relatively simple to diag-
nose, once it has taken hold. thus, the prescription of antibiotics
may follow a simple investigation by a general practitioner. a more
speci?c characterisation of the infectious agent may be carried out
using microbiological culturing techniques, and this is often neces-
sary when the infection does not respond well to treatment. viral
infections may be more dif?cult to diagnose, although conditions
such as herpes infections are usually obvious.
despite traditional methods being applied in many cases, there
may be times when these methods are not appropriate. infection by
the human immunodeficiency virus (hiv) is one case in point. the in some cases, viral infections
can be diagnosed by using rdna
techniques (such as pcr) to
identify viral dna before
antibodies have reached
detectable levels.
virus is the causative agent of acquired immune deficiency syndrome
(aids). the standard test for hiv infection requires immunological
detection of anti-hiv antibodies, using techniques such as elisa
(enzyme linked inmmunosorbent assay, sometimes known as the
enzyme immunoassay), western blot, and ifa (indirect immunoflu-
orescence assay). however, these antibodies may not be detectable in
an infected person until weeks after initial infection, by which time
others may have been infected. a test such as this, where no posi-
tive result is obtained even though the individual is infected, is a
false negative. the use of dna probes and pcr technology circum-
vents this problem by assaying for nucleic acid of viral origin in the
t-lymphocytes of the patient, thus permitting a diagnosis before the
antibodies are detectable.
other examples of the use of rdna technology in diagnosing
infections include tuberculosis (caused by the bacterium mycobac-
terium tuberculosis), human papilloma virus infection, and lyme dis-
ease (caused by the spirochaete borrelia burgdorferi).
12.1.2 patterns of inheritance
although diagnosis of infection is an important use of rdna technol-
ogy, it is in the characterisation of genetic disease that the technology
has perhaps been most applied in medicine to date. before dealing
with some speci?c diseases in more detail, it may be useful to review
the basic features of transmission genetics, and outline the range of
factors that may determine how a particular disease state presents in
a patient.
since it was rediscovered in 1900, the work of gregor mendel has
formed the basis for our understanding of how genetic characteristics
are passed on from one generation to the next. we have already seen
transmission genetics, the
principles of which were ?rst
established by gregor mendel, is
still an important part of modern
medicine. molecular genetics
complements transmission
genetics to provide a powerful
range of methods for genetic
analysis.
that the human genome is made up of some 3 billion base pairs of in-
formation. this is organised as a diploid set of 46 chromosomes,
arranged as 22 pairs of autosomes and one pair of sex chromo-
somes. prior to reproduction, the haploid male and female gametes
(sperm and oocyte, respectively) are formed by the reduction divi-
sion of meiosis, which reduces the chromosome number to 23. onmedical and forensic applications of gene manipulation 229
fertilisation of the oocyte by the sperm, diploid status is restored, with
the zygote receiving one member of each chromosome pair from the
father and one from the mother. in males the sex chromosomes are
x and y, in females xx, and thus it is the father that determines the
sex of the child.
traits may be controlled by single genes, or by many genes act-
ing in concert. single-gene disease traits are known as monogenic
disorders, whilst those involving many genes are polygenic. inheri-
tance of a monogenic disease trait usually follows a basic mendelian
pattern and can therefore often be traced in family histories by
genetic traits can be transmitted
from generation to generation in
different ways. these patterns of
inhertiance follow set ‘rules’ and
can be useful in the diagnosis and
tracing of disease patterns in
families.
pedigree analysis. a gene may have alleles (different forms) that
may be dominant (exhibited when the allele is present) or reces-
sive (the effect is masked by a dominant allele). with respect to
a particular gene, individuals are said to be either homozygous
(both alleles the same) or heterozygous (the alleles are different,
perhaps one dominant and one recessive). patterns of inheritance of
monogenic traits can be associated with the autosomes, as either
autosomal dominant or autosomal recessive, or may be sex-linked
(usually with the x chromosome, thus showing x-linked inheri-
tance). the mendelian patterns and ratios for these types of inher-
itance are shown in fig. 12.1. in addition to the nuclear chromo-
somes, mutated genes associated with the mitochondrial genome can
cause disease. as the mitochondria are inherited along with the egg,
these traits show maternal patterns of inheritance. we will con-
sider speci?c examples of the patterns of inheritance in the next
section.
the effect of a gene depends not only on its allelic form and char-
acter but also on how it is expressed. the terms penetrance and
expressivity are used to describe this aspect. penetrance is usually
quoted as the percentage of individuals carrying a particular allele
who demonstrate the associated phenotype. expressivity refers to the
degree to which the associated phenotype is presented (the severity
of the phenotype is one way to think of this). thus, alleles show-
ing incomplete penetrance and/or variable expressivity can greatly
affect the range of phenotypes derived from what is actually a simple
mendelian pattern of inheritance. further complications arise when
multiple alleles are involved in determining traits, or when alleles
demonstrate incomplete dominance, co-dominance, or partial dom-
inance. in many cases the route from genotype to phenotype also
involves one or more environmental factors, when traits are said to
be of a multifactorial nature.
despite the complexities of transmission patterns and outcomes,
there are many cases where the defect can be traced with reasonable
certainty. as stated in chapter 10, data for transmission of disease
online mendelian inheritance in
man is another good example of
how the availability of powerful
desktop computers and the
internet has transformed the way
we deal with complex data sets.
traits are collated in online mendelian inheritance in man (omim),
which now runs to over 17000 entries in various categories. the
database is the electronic version of the text mendelian inheritance in
man, by victor mckusick of johns hopkins university, who published
the ?rst edition in 1966. mckusick is rightly considered to be the
father of medical genetics.230 genetic engineering in action
(a) autosomal dominant
genotype:
phenotype:
aa
affected male
genotype:
phenotype:
aa
normal female
x
aa aa
aa aa
a
a
a a
genotype ratio is 1:1
to
thus 50% affected
50% normal
aa aa
(b) autosomal recessive
bb bb
bb bb
genotype:
phenotype:
bb
carrier male
genotype:
phenotype:
bb
carrier female
x
b
b
b b
genotype ratio is 1:2:1

phenotype ratio is 3:1
thus 25% affected
75% normal
bb/bb/bb
(c) x-linked
genotype: xy
genotype: x x c
x
xx x x c
xy x y c
x
y
x x
c
genotype ratio is 1:1:1:1

thus 50% of male
children are affected
xx/xy/x x/x y c c
phenotype: normal male
phenotype: carrier female
fig. 12.1 patterns of inheritance. (a) an autosomal dominant disease allele is
designated a, normal form a. half of the gametes from an affected individual (in this case
the male) will carry the disease allele. on mating (box diagram) the gametes can mix in
the combinations shown. the result is that half the offspring will be heterozygous and,
therefore, have the disease (shown by shaded boxes). (b) an autosomal recessive pattern.
the disease-causing allele is designated b, the normal variant b. on a mating between
two carriers heterozygous for the defective allele, there is a one-in-four chance of having
an affected child. (c) an x-linked pattern for a disease allele designated c. in this case a
recessive allele is shown. half of the male children will be affected, as there is only one x
chromosome and, thus, no dominant allele to mask the effect. no female children are
affected. however, in the case of an x-linked dominant allele, females are also affected.
12.1.3 genetically based disease conditions
genetic problems may arise from either chromosomal abnormalities
(aberrations) or gene mutations. an abnormal chromosome comple-
ment can involve whole chromosome sets (variation in the ploidy
number, such as triploid, tetraploid, etc.) or individual chromosomesmedical and forensic applications of gene manipulation 231
table 12.1. examples of types of chromosomal aberrations in humans
condition
chromosome
designation syndrome frequency per live births
autosomal
trisomy-13 47, 13 + patau syndrome 1:12 500–1:22 000
trisomy-18 47, 18 + edwards syndrome 1:6 000 -1:10 000
trisomy-21 47, 21 + down syndrome 1:800
sex chromosome variation
missing y 45, x turner syndrome 1:3 000 female births
additional x 47, xxx triplo-x 1:1 200 female births
additional x 47, xxy klinefelter syndrome 1:500 male births
additional y 47, xyy jacobs syndrome 1:1 000 male births
structural defects cause
deletion part of chromosome deletingd e.g. abcdefgh ? abfgh
duplication part of chromosome duplicated e.g. abcdefgh ? abcdbcdefgh
inversion part of chromosome inverted e.g. abcdefgh ? abcfedgh
translocation fragment moved to different chromosome e.g. abcdefgh ?
pqrdefstuv
fragile-x syndrome region of x-chromosome susceptible to breakage known as martin–bell
syndrome, presenting as 1:1 250 male births and 1:2 500 female births
note: chromosome designation lists the total number of chromosomes, followed by the specific defect. thus, 47,
13 + indicates an additional chromosome 13, and 47, xxy a male with an additional x chromosome. the syndrome
is usually named after the person who first described it the possessive (e.g. down’s syndrome) is sometimes still
used, but the modern convention is to use the non-possessive (e.g. down syndrome).
(aneuploidy). any such variation usually has very serious conse-
quences, often resulting in spontaneous abortion, as gene dosage is
affected and many genes are involved. multiple chromosome sets are
rare in most animals but are quite often found in plants. as gamete
chromosomal abnormalities
often have very serious effects
on the organism, as the
disruption to normal genetic
balance is usually severe.
formation involves meiotic cell division in which homologous chro-
mosomes separate during the reduction division, even-numbered mul-
tiple sets are most commonly found in polyploid plant species that
remain stable.
aneuploidy is a much more common form of chromosomal varia-
tion in humans, but is still relatively rare in terms of live-birth presen-
tations. a missing chromosome gives rise to a monosomic condition,
which is usually so severe that the foetus fails to develop fully. an
additional chromosome gives a trisomic condition, which is more
likely to persist to term. monosomy and trisomy can affect both auto-
somes and sex chromosomes, with several recognised syndromes such
as down syndrome (trisomy-21). most cases involving changes to chro-
mosome number are caused by non-disjunction at meiosis during
gamete formation. in addition to variation in chromosome number,
structural changes can affect parts of chromosomes and can cause a
range of conditions. some examples of chromosomal aberrations in
humans are shown in table 12.1.232 genetic engineering in action
table 12.2. selected monogenic traits in humans
inheritance
pattern/disease frequency per live births features of the disease condition
autosomal recessive
cystic ?brosis 1:2000–1:2500 in western
caucasians
ion transport defects lung infection
and pancreatic dysfunction result
tay-sachs disease 1:3000 in ashkenazi jews neurological degeneration, blindness,
and paralysis
sickle-cell anaemia 1:50–1:100 in african
populations where
malaria is endemic
sickle-cell disease affects red blood
cells heterozygous genotype confers
a level of resistance to malaria
phenylketonuria 1:2000–1:5000 mental retardation due to
accumulation of phenylalanine
? 1 -antitrypsin de?ciency 1:5000–1:10000 lung tissue damage and liver failure
autosomal dominant
huntington disease 1:5000–1:10000 late onset motor defects, dementia
familial 1:500 premature susceptibility to heart
disease hypercholesterolaemia
breast cancer genes
brca1 and 2
1:800 (1:100 in ashkenazi
jews)
susceptibility to early onset breast and
ovarian cancers
familial retinoblastoma 1:14000 tumours of the retina
x-linked
duchenne muscular
dystrophy
1:3000–1:4000 muscle wastage, teenage onset
haemophilia a/b 1:10000 defective blood clotting mechanism
mitochondrial
leber hereditary optic
neuropathy (lhon)
mitochondrial defect,
maternally inherited/late
onset thus dif?cult to
estimate
optic nerve damage, may lead to
blindness, but complex penetrance
of the defective gene due to
mitochondrial pattern of inheritance
although chromosomal abnormalities are a very important type
of genetic defect, it is in the characterisation of gene mutations that
molecular genetics has had the most impact. many diseases have now
been almost completely characterised, with their mode of transmis-
sion and action de?ned at both the chromosomal and molecular lev-
els. table 12.2 lists some of the more common forms of monogenic
disorder that affect humans. we will consider some of these in more
detail to outline how a disease can be characterised in terms of the
effects of a mutated gene.
cystic fibrosis (cf) is the most common genetically based disease
found in western caucasians, appearing with a frequency of around
1 in 2000 2500 live births. it is transmitted as an autosomal reces-
sive characteristic and, therefore, the birth of an affected child may
be the ?rst sign that there is a problem in the family. the carriermedical and forensic applications of gene manipulation 233
frequency for the cf defective allele is around 1 in 20 25 people. the
disease presents with various symptoms, the most serious of which
cystic ?brosis is an example of a
serious disease that has been
studied from the viewpoint of
molecular, transmission, and
population genetics.
is the clogging of respiratory passageways with thick, sticky mucus.
this is too thick to be moved by the cilia that line the air passages,
and the patient is likely to suffer persistent and repeated infections.
lung function is therefore compromised in cf patients, and even with
improved treatments the life expectancy is only around 30 years. the
pancreatic duct may also be affected by cf, resulting in pancreatic
exocrine deficiency, which causes problems with digestion.
cystic ?brosis can be traced in european folklore, from which the
following puzzling statement comes: ‘woe to that child which when kissed
on the forehead tastes salty. he is bewitched and soon must die’. the condi-
tion was ?rst described clinically in 1938, although characterisation
of the disease at the molecular level was not achieved until the gene
responsible was cloned in 1989. the defect responsible for cf affects
a membrane protein involved in chloride ion transport, which results
in epithelial cell sheets having insuf?cient surface hydration hence
the sticky mucus. there is also an increase in the salt content of
sweat hence the statement quoted earlier. the gene/protein respon-
sible for cf is called the cystic fibrosis transmembrane conductance
regulator (cftr). so how was the gene cloned and characterised?
the hunt for the cf gene is a good example of how the technique
of positional cloning can be used to ?nd a gene for which the protein
product is unknown, and for which there is little cytogenetic or link-
age information available. positional cloning, as the name suggests,
involves identifying a gene by virtue of its position essentially by
deciphering the molecular connection between phenotype and geno-
type. in 1985, a linkage marker (called met) was found that localised
the cf gene on the long arm of chromosome 7. the search for other
markers uncovered two that showed no recombination with the cf
locus thus, they were much closer to the cf gene. these markers
were used as the start points for a trawl through some 280 kbp of
dna, looking for potential cf genes. this was done using the tech-
niques of chromosome walking and chromosome jumping to search
for contiguous dna sequences from clone banks (this was before yeast
and bacterial arti?cial chromosome vectors enabled large fragments
to be cloned). the basis of chromosome walking and jumping is shown
location and identi?cation of the
cftr gene was a major
breakthrough in medical
genetics.
in fig. 12.2. using these methods, four candidate genes were identi-
?ed from coding sequence information, and by tracing patterns of
expression of each of these in cf patients, the search uncovered the
5

end of a large gene that was expressed in the appropriate tissues.
this became known as the cftr gene. a summary of the hunt for
cftr is shown in fig. 12.3.
having identi?ed the cftr gene, more detailed characterisation
of its normal gene product, and the basis of the disease state, could
begin. the gene is some 250 kbp in size and encodes 27 exons that
produce a protein of 1480 amino acids. the protein is similar to the
atp-binding cassette family of membrane transporter proteins. when
the gene was being characterised, it was noted that around 70% of cf234 genetic engineering in action
(a) chromosome walking
(b) chromosome jumping
marker target gene
overlapping cloned fragments
jump jump
walk walk
clone 1
unknown or unclonable
region of the genome
cloned region
non-adjacent probes used to jump
along the chromosome
fig. 12.2 chromosome walking and jumping. chromosome walking (a) uses probes
derived from the ends of overlapping clones to enable a ‘walk’ along the sequence. thus,
a probe from clone 1 identi?es the next clone, which then provides the probe for the
next, and so on. in this way a long contiguous sequence can be assembled. in
chromosome jumping (b), regions that are dif?cult to clone can be ‘jumped’. the probes
are prepared using a technique that enables fragments from distant sites to be isolated in
a single clone by circularising a large fragment and isolating the region containing the
original probe and the distant probe. this can then be used to isolate a clone containing
sequences from the distant region. often a combination of walks and jumps is needed to
move from a marker (such as an rflp) to a gene sequence. from nicholl (2000), cell &
molecular biology, advanced higher monograph series, learning and teaching scotland.
reproduced with permission.
cases appeared to have a similar defective region in the sequence
a three-base-pair deletion in exon 10. this causes the amino acid
phenylalanine to be deletingd from the protein sequence. this muta-
tion is called the f508 mutation ( for deletion, f is a single-letter
abbreviation for phenylalanine, and 508 is the position in the primary
sequence of the protein). it affects the folding of the cftr protein,
which means that it cannot be processed and inserted into the mem-
brane correctly after translation. thus, patients who carry two f508
alleles do not produce any functional cftr, with the associated dis-
ease phenotype arising as a consequence of this. the f508 mutation
is summarised in fig. 12.4.
molecular characterisation of a gene opens up the possibility of
accurate diagnosis of disease alleles. although screening for cf tradi-
tionally involved the ‘sweat test’, there is now a range of molecular
techniques that can be used to con?rm the presence of a defective
cftr allele, which can enable heterozygous carriers to be identi?ed
with certainty. two of these involve the use of pcr to amplify amedical and forensic applications of gene manipulation 235
(a)
(b)
(c)
chromosome 7
band
7q22
cf
0 100 200 300 400 500 kbp
280 kb contig
?
1 2 3 4
cftr gene
(d)
fig. 12.3 the hunt for the cystic ?brosis gene. (a) mapping studies placed the gene on
the long arm of chromosome 7, at band position 7q22. (b) markers associated with this
region (square, triangle, and circle) were mapped in relation to the cf gene. (c) a region
of some 500 kbp was examined and a contiguous sequence (clone ‘contig’) of 280 kbp
was identi?ed. this region contained 4 candidate gene sequences or open reading frames
(orfs, labelled1–4). further analysis of mrna transcripts and dna sequences
eventually identi?ed orf 4 as the start of the ‘cf gene’, which was named the cystic
?brosis transmembrane conductance regulator (cftr) gene.
fragment around the f508 region to identify the 3 bp deletion,
and the use of allele-specific oligonucleotides (asos) in hybridisa-
tion tests. the use of these techniques is shown in fig. 12.5.
although the f508 mutation is the most common cause of cf,
to date around 1500 mutations have been identi?ed in the cftr
gene. a database of these is maintained by staff at the hospital for
many different mutations of the
cftr gene have been identi?ed,
although the most prevalent is
the absence of phenylalanine at
position 508 in the protein.
sick children in toronto, where the gene was discovered, and can
be found at http://www.genet.sickkids.on.ca/cftr/app. many types of
mutation have been characterised, including promoter mutations,
frameshifts, amino acid replacements, defects in splicing, and dele-
tions. with more sophisticated diagnosis, patients are being diag-
nosed with milder presentations of cf, which may not appear as early
or be as severe as the f508-based disease. thus, the cf story provides
a good illustration of the scope of molecular biology in medical diag-
nosis, as it has enabled the common form of the disease to be char-
acterised and has also extended our knowledge of how highly poly-
morphic loci can in?uence the range of effects that may be caused
by mutation.
in the area around lake maracaibo in venezuela, there is a large
family group of people who are descended from a woman who
had migrated from europe in the 1800s. members of this group
share a common ailment. they begin to exhibit peculiar involuntary236 genetic engineering in action
(a)
(b)
f508
?f508
(250 kbp)
primary transcript
(6.5 kb)
dna
rna
mrna
transcription
rna processing
translation
normal cftr
fig. 12.4 the cystic ?brosis f508 mutation. (a) the cf gene. transcription produces
the primary rna transcript that is converted into the functional 6.5 kb mrna by
removal of intervening sequences. on translation the transmembrane conductance
regulator protein (cftr) is produced. (b) the normal and mutant proteins are shown.
normal cftr has phenylalanine (f) at position 508. in the mutant f508 protein this is
deletingd, causing the protein to fold incorrectly, which prevents it reaching the site of
incorporation into the membrane. from nicholl (2000), cell & molecular biology,
advanced higher monograph series, learning and teaching scotland. reproduced with
permission.
movements and also suffer from dementia and depression. time of
onset is usually around the age of 40 50. their children, who were
born when their parents were healthy, also develop the symptoms
of this distressing condition, which is known as huntington disease
(hd previously known as huntington’s chorea, which describes the
choreiform movements of sufferers).
a clinical psychologist named nancy wexler has made a long-term
study of thousands of hd sufferers from the lake maracaibo popula-
tion, by carrying out an extensive pedigree analysis. this con?rmed
pedigree analysis can be an
invaluable tool for tracing the
pattern of inheritance of a trait
in a population.
that hd follows an autosomal dominant pattern of inheritance, where
the presence of a single defective allele is enough to trigger the dis-
ease state. thus, children of an affected parent have a 50% chance of
inheriting the condition. as the disease presents with late onset (rel-
ative to childbearing age), many people would wish to know if they
carried the defective allele, so that informed choices could be made
about having a family. the search for the gene responsible for hd
involved tracing a restriction fragment length polymorphism (rflp)
that is closely linked to the hd locus. the rflp, named g8, was iden-
ti?ed in 1983. it segregates with the hd gene in 97% of cases. the hd
gene itself was ?nally identi?ed in 1993, located near the end of themedical and forensic applications of gene manipulation 237
(a) normal and mutant f508 sequences
normal gene sequence 5 - gaa aat atc at t ggt gtt tcc - 3 c tt
ile ile phe gly
mutant gene sequence gaa aat atc att ggt gtt tcc
ile ile gly
(b) pcr amplification of deletingd region
(c) using allele-specific oligonucleotide probes
aso 1 (normal) 3 - cttttatagtagaaaccacaaagg - 5
aso 2 (mutant) 3 - cttttatagtaaccacaaagg
f508 /
f508
+/+
f508
+/
dot-blot
hybridisation
aso 1 (normal)
aso 2 (mutant)
larger
smaller
3 nt
difference
1 2 3
f508 /
f508
+/+
f508
+/
- 5
- 3 5 -
fig. 12.5 diagnosis of f508 cf allele. (a) the normal and mutant gene sequences
around position 508 (phe) are shown. the deletingd 3 base pairs are shaded in the normal
sequence. this causes loss of phenylalanine. (b) a pcr-based test. a 100-base-pair
region around the deletion is ampli?ed using pcr, and the products run on a gel that will
discriminate between the normal fragment and the mutant fragment, which will be 3
nucleotides smaller. lanes 1, 2, and 3 show patterns obtained for homozygous normal
( + / + ), heterozygous carrier ( + / f508), and homozygous recessive cf patient
( f508/ f508). (c) a similar pattern is seen with the use of allele-speci?c
oligonucleotide probes (asos). the probe sequence is shown, derived from the gene
sequences shown in (a). by amplifying dna samples from patients using pcr and
performing a dot-blot hybridisation with the radiolabelled asos, simple diagnosis is
possible. in this example hybridisation with each probe separately enables the three
genotypes to be determined by examining an autoradiograph.
short arm of chromosome 4. the defect involves a relatively unusual
form of mutation called a trinucleotide repeat. the hd gene has
multiple repeats of the sequence cag, which codes for glutamine. in
normal individuals, the gene carries up to 34 of these repeats. in hd
alleles, more than 42 of the repeats indicates that the disease con-
dition will appear. there is also a correlation between the number
of repeats and the age of onset of the disease, which appears ear-
lier in cases where larger numbers of repeats are present. as with
cf, the availability of the gene sequence enables diagnostic tests to238 genetic engineering in action
be developed for hd. using pcr, the repeat region can be ampli?ed
and the products separated by gel electrophoresis to determine the
number of repeats and, thus, the genetic fate of the individual with
respect to hd.
most x-linked gene disorders are recessive. however, their pattern
of inheritance means that they are effectively dominant in males (xy)
as there is no second allele present as would be the case for females
(xx), or in an autosomal diploid situation. thus x-linked diseases are
often most serious in boys, as is the case for muscular dystrophy (md).
this is a muscle wasting disease that is progressive, usually from a
the dystrophin gene, which is
involved in muscular dystrophy,
is vast – some 2.4 mb in length.
teenage onset, which causes premature death. the severe form of
the disease is called duchenne muscular dystrophy (dmd), although
there is a milder form called becker muscular dystrophy (bmd).
both these defects map to the same location on the x chromosome.
the md gene was isolated in 1987 using positional cloning techniques.
it is extraordinarily large, covering 2.4 mb of the x chromosome (that’s
2 400 kbp, or around 2% of the total!). the 79 exons in the md gene
produce a transcript of 14 kb, which encodes a protein of 3 685 amino
acids called dystrophin. its function is to link the cytoskeleton of
muscle cells to the sarcolemma (membrane).
the md gene shows a much higher rate of mutation than is usual
some two orders of magnitude higher than other x-linked loci. this
may simply be due to the extreme size of the gene, which therefore
presents an ‘easy target’ for mutation. most of the mutations charac-
terised so far are deletions. those that affect reading frame generally
cause the severe dmd, whilst deletions that leave reading frame intact
tend to be associated with bmd.
12.2 treatment using rdna technology – gene
therapy
once genetic defects have been identi?ed and characterised, the pos-
sibility of treating the patient arises. if the defective gene can be
replaced with a functional copy (sometimes called the transgene, as
in transgenic) that is expressed correctly, the disease caused by the
defect can be prevented. this approach is known as gene therapy.
although it has not yet ful?lled its early expectations, it remains
gene therapy holds great
promise that has not yet been
fully realised.
one of the most promising aspects of the use of gene technology in
medicine. there are two possible approaches to gene therapy: (1) intro-
duction of the transgene gene into the somatic cells of the affected
tissue or (2) introduction into the reproductive cells (germ line cells).
these two approaches have markedly different ethical implications.
most scientists and clinicians consider somatic cell gene therapy an
acceptable practice no more morally troublesome than taking an
aspirin. however, tinkering with the reproductive cells, with the prob-
ability of germ line transmission, is akin to altering the gene pool of
the human species, which is regarded as unacceptable by most people.medical and forensic applications of gene manipulation 239
thus, genetic engineering of germ cells is an area that is likely to
remain off limits at present.
there are several requirements for a gene therapy protocol to be
effective. first, the gene defect itself will have been characterised,
and the gene cloned and available in a form suitable for use in a
clinical programme. second, there must be a system available for get-
ting the gene into the correct site in the patient. essentially these
are vector systems that are functionally equivalent to vectors in a
standard gene cloning protocol their function is to carry the dna
sequence into the target cells. this also requires a mechanism for
physical delivery to the target, which may involve inhalation, injec-
tion, or other similar methods. finally, if these requirements can be
satis?ed, the inserted gene must be expressed in the target cells if a
non-functional gene is to be ‘corrected’. ideally, the faulty gene would
although the concept of gene
replacement or substitution
therapy is elegantly simple, it is
much more dif?cult to achieve in
reality.
be replaced by a functional copy. this is known as gene replace-
ment therapy and requires recombination between the defective gene
and the inserted functional copy. because of technical dif?culties in
achieving this reliably in target cells, the alternative is to use gene
addition therapy. in addition therapy there is no absolute require-
ment for reciprocal exchange of the gene sequences, and the inserted
gene functions alongside the defective gene. this approach is useful
only if the gene defect is not dominant, in that a dominant allele
will still produce the defective protein, which may overcome any
effect of the transgene. therapy for dominant conditions could be
devised using antisense mrna, in which a reversed copy of the gene
is used to produce mrna in the antisense con?guration. this can
bind to the mrna from the defective allele and effectively prevent its
translation. antisense technology will be discussed in more detail in
chapter 13.
a further complication in gene therapy is the target cell or tis-
sue system itself. in some situations it may be possible to remove
cells from a patient and manipulate them outside the body. the
altered cells are then replaced, with function restored. this approach
is known as
ex vivo
gene therapy. it is mostly suitable for diseases
that affect the blood system. it is not suitable for tissue-based dis-
eases such as dmd or cf, in which the problem lies in dispersed
and extensive tissue such as the lungs and pancreas (cf) or the skele-
tal muscles (dmd). it is dif?cult to see how these conditions could
be treated by ex vivo therapy therefore, the technique of treating
these conditions at their locations is used. this is known as
in vivo
gene therapy. features of these two types of gene therapy are illus-
trated in fig. 12.6, with both approaches having been used with some
success.
12.2.1 getting transgenes into patients
before looking at two examples of gene therapy procedures, it is worth
reviewing the key methods available for getting the transgene into the
cells of the patient. as we have seen, there are two aspects to this.240 genetic engineering in action
(a) in vivo gene therapy
(b) ex vivo gene therapy
insert transgene
into liposomes or
lipoplexes, or viral
vector/vehicle systems
grow cells ex vivo
remove cells
replace the
modified cells
add transgene and
select modified cells
deliver to site of
action ( lung) by
aerosol spray
e.g.
fig. 12.6 in vivo and ex vivo routes for gene therapy. the in vivo approach is shown in
(a). the gene is inserted into a vector or liposome/lipoplex and introduced into target
tissue of the patient. in this case the lung is the target, and an aerosol can be used to
deliver the transgene. such an approach can be used with cystic ?brosis therapy. (b) the
ex vivo route. cells (e.g. from blood or bone marrow) are removed from the patient and
grown in culture medium. the transgene is therefore introduced into the cells outside
the body. modi?ed cells can be selected and ampli?ed (as in a typical gene cloning
protocol with mammalian cells) before they are injected back into the patient.
the biology of the system must be established and evaluated, and
then the physical method for getting the gene to the site of action has
to be considered. deciding on the best method for addressing these
two aspects of a therapeutic procedure is one important part of the
strategy.
as with vectors for use in cloning procedures, viruses are an attrac-
tive option for delivering genes into human cells. we can use the term
vector in its cloning context, as a piece of dna into which the trans-
gene is inserted. the viral particle itself is often called the vehicle for
delivery of the transgene, although some authors describe the whole
many of the problems associated
with gene therapy have been due
to the viral vectors used for
delivery of the treatment gene.
system simply as a vector system. the main viral systems that have
been developed for gene therapy protocols are based on retroviruses,
adenoviruses, and adeno-associated viruses. the advantage of viral
systems is that they provide a speci?c and ef?cient way of getting
dna into the target cells. however, care must be taken to ensure that
viable virus particles are not generated during the therapy procedure,
as this would potentially be detrimental to the patient.
in addition to viral-based systems, dna can be delivered to target
cells by non-viral methods. naked dna can be used directly, although
this is not an ef?cient method. alternatively, the dna can be encap-
sulated in a lipid micelle called a liposome. development of thismedical and forensic applications of gene manipulation 241
table 12.3. vector/vehicle systems for gene therapy
system features
viral-based
retroviruses rna genome, usually used with cdna,
requires proliferating cells for incorporation
of the transgene into the nuclear material.
not speci?c for one cell type and can
activate cellular oncogenes.
adenoviruses double-stranded dna genome, virus infects
respiratory and gastrointestinal tract cells,
thus effective in non- or slowly dividing
cells. generally provokes a strong immune
response.
adeno-associated
viruses
replication-defective, thus requires helper
virus. some bene?ts over adenoviral
systems may show chromosome-speci?c
integration of transgene.
non-viral
liposomes system based on lipid micelles that
encapsulate the dna. some problems
with size, as micelles are generally small and
may restrict the amount of dna
encapsulated. inef?cient compared to viral
systems.
lipoplexes bene?ts over liposomes include increased
ef?ciency due to charged groups present
on the constituent lipids. non-
immunogenic, so bene?ts compared to
viral systems.
naked dna inef?cient uptake but may be useful in certain
cases.
technique produced more complex structures that resemble viral par-
ticles, and these were given the name lipoplexes to distinguish them
from liposomes. some features of selected delivery systems are shown
in table 12.3.
when a delivery system is available, the patient can be exposed
to the virus in a number of ways. delivery into the lungs by aerosol
inhalation is one method appropriate to in vivo therapy for cf, as this
is the main target tissue. injection or infusion are other methods that
may be useful, particularly if an ex vivo protocol has been used.
12.2.2 gene therapy for adenosine deaminase de?ciency
the ?rst human gene therapy treatment was administered in septem-
ber 1990 to a four-year-old girl named ashanti dasilva, who received242 genetic engineering in action
her own genetically altered white blood cells. ashanti suffered from
a recessive defect known as adenosine deaminase (ada) deficiency,
which causes the disease severe combined immunodeficiency syn-
drome. although a rare condition, this proved to be a suitable target
gene therapy for ada de?ciency
was the ?rst successful
demonstration that the process
could improve the condition. for ?rst steps in gene therapy in that the gene defect was known (the
32 kbp gene for ada is located on chromosome 20), and an ex vivo strat-
egy could be employed. before gene therapy was available, patients
could be treated by enzyme replacement therapy. a major develop-
ment in this area was preparing the ada enzyme with polyethylene
glycol (the main component of antifreeze!) to stabilise delivery of the
enzyme. the treatment is still important as an additional supplement
to gene therapy, the response to which can be variable in different
patients.
for the ?rst ada treatments, lymphocytes were removed from
the patients and exposed to recombinant retroviral vectors to deliver
the functional ada gene into the cells. the lymphocytes were then
replaced in the patients. further developments came when bone mar-
row cells were used for the modi?cation. the stem cells that produce
t-lymphocytes are present in bone marrow thus, altering these pro-
genitor cells should improve the effect of the ada transgene, partic-
ularly with respect to the duration of the effect. the problem is that
t-lymphocyte stem cells are present as only a tiny fraction of the bone
marrow cells and, thus, ef?cient delivery of the transgene is dif?cult.
umbilical cord blood is a more plentiful source of target cells, and
this method has been used to effect ada gene therapy in newborn
infants diagnosed with the defect.
12.2.3 gene therapy for cystic ?brosis
cf is an obvious target for gene therapy, as it presents much more
frequently than ada de?ciency and is a major health problem. drug
therapies can help to alleviate some of the symptoms of cf by diges-
tive enzyme supplementation and the use of antibiotics to counter
infection. however, as with ada, enzyme replacement therapy is an
attack on the symptoms of the disease, rather than on the cause. as
outlined in section 12.1.3, the defective gene/protein involved in cf
has been de?ned and characterised. as cf is a recessive condition
cause by a faulty protein, if a functional copy of the cftr gene could
be inserted into the appropriate tissue (chie?y the lung) then normal
cftr protein could be synthesised by the cells and, thus, restore the
normal salt transport mechanism. early indications that this could
be achieved came from experiments that demonstrated that normal
cftr could be expressed in cell lines to restore defective cftr func-
tion, thus opening up the real possibility of using this approach in
patients.
development of a suitable therapy for a disease such as cf usually
involves developing an animal model for the disease, so that research
can be carried out to mimic the therapy in a model system before it
reaches clinical trials. in cf, the model was developed using trans-
genic mice that lack cftr function. adenovirus-based vector/vehiclemedical and forensic applications of gene manipulation 243
table 12.4. vectors and delivery methods used in gene
therapy trials since 1989
vector/delivery method
number
of trials % of total
adenovirus 318 25.2
retrovirus 290 23
naked/plasmid dna 229 18.2
lipofection 99 7.9
vaccinia virus 63 5
poxvirus 60 4.8
adeno-associated virus 46 3.7
herpes simplex virus 43 3.4
poxvirus + vaccinia virus 25 2
rna transfer 16 1.3
lentivirus 8 0.6
other vectors/methods 43 3.4
unknown 36 2.9
total 1260
note: data show the number of gene therapy trials using different
types of vector or delivery methods. in total, 1260 trials have been
recorded from 1989 to 2007.
source: data selected from gene therapy clinical trials worldwide, pro-
vided by the journal of gene medicine, copyright john wiley & sons
ltd (2004, 2007). url [http://www.wiley.co.uk/genmed/clinical/]. data
manager m. edelstein. reproduced with permission.
systems were used, and these were shown to be effective. thus, the
system seemed to be effective, and human trials could begin. in mov-
ing into a human clinical perspective, there are several things that
need to be taken into account in addition to the science of the gene
and its delivery system. for example, how can the ef?cacy of the tech-
nique be measured? as cf therapy involved cells deep in the lung, it
is dif?cult to access these cells to investigate the expression of the
normal cftr transgene. using nasal tissue can give some indications,
but this is not completely reliable. also, how effective must the trans-
gene delivery/expression be in order to produce a clinically signi?cant
effect? do all the affected cells in the lung have to be ‘repaired’, or
will a certain percentage of them enable restoration of near-normal
levels of ion transport?
despite the problems associated with devising, applying, and mon-
itoring gene therapy for cf, over 1200 clinical trials have been insti-
gated from 1989 to date (see table 12.4), with some successes achieved.
the availability of gene therapy
‘medicine’ in an off-the-shelf,
reliable, and tested form for a
variety of diseases is still a long
way off, despite steady progress.
both viral-based and liposome/lipoplex delivery systems have been
used, although the application of cf gene therapy by a widely avail-
able, robust, and effective method is still relatively distant. however,
steady progress is being made, and many scientists believe that an
effective therapy for cf is within reach.244 genetic engineering in action
12.2.4 what does the future hold for gene therapy?
as stated earlier, gene therapy has not yet realised its full poten-
tial in effective clinical applications. whilst this is dissapointing, the
very rapid pace of developments in modern genetics sometimes leads
to the expectation of ‘instant success’. unfortunately something like
gene therapy presents a number of very complex challenges and, thus,
we should maybe not be too surprised when progress is not as rapid
as we would wish. at present gene therapy is still an experimental
application, and, as the technology is not fully developed, at times
there may be problems. in the 10-year period from 1990, several thou-
sand patients were treated by gene therapy, mostly without long-term
success.
lack of success is of course dissapointing (and often devastating)
from the patient’s perspective, but more distressing are cases involv-
ing the deaths of patients. most of the dif?culties tend to be associ-
ated with the use of viral vectors. in 1999 a young man named jesse
any novel process will run into
dif?culties in medical
applications the consequences
are often distressing and can
prove to be serious setbacks.
gelsinger was undergoing gene therapy for ornithine transcarbamy-
lase deficiency. sadly, he suffered an adverse reaction to the vector
and died a few days after treatment. another setback was the develop-
ment of a leukaemia-like disease in patients in a french trial that had
initially delivered a positive outcome for the treatment of x-linked
severe combined immunodeficiency syndrome. following any major
setbacks like these, it often takes a number of years before public
con?dence is restored.
in addition to the obvious scienti?c and medical challenges in-
volved, there are very real ethical concerns around gene therapy.
as already mentioned, the difference between somatic cell therapy
and germ line therapy is a clear distinction that is accepted by most
the potential for enhancing an
individual’s characteristics by
gene therapy raises dif?cult
ethical questions.
scientists. however, as we move on in terms of societal ethics, this
distinction may become blurred and the position may even be ques-
tioned. an additional ethical problem arises when we consider gene
therapy in the context of enhancing characteristics rather than treat-
ing disease. the potential use of enhancement gene therapy, whereby
certain traits in an individual could be enhanced by the technique,
raises very dif?cult ethical issues, and in some senses really does bring
the potential for ‘designer babies’ closer.
12.3 rna interference – a recent discovery with
great potential
as we saw in chapter 7 when we considered the pcr, from time to
time a new discovery appears that enables a step change in a disci-
pline. the discovery of rna interference (rnai) is one recent example many scientists think that rna
interference has the potential to
be a major therapeutic tool in
combating a wide range of
diseases.
of this, for which andrew fire and craig mello were awarded the
2006 nobel prize in physiology or medicine. rnai is a fascinating
and complex topic, which we will not be able to do justice to in this
book. however, there are potentially very signi?cant applications inmedical and forensic applications of gene manipulation 245
both basic science and in therapeutics, so it is important to at least
introduce the basics of what rnai is and what it can be used for.
12.3.1 what is rnai?
rnai was discovered in 1998 in the nematode caenorhabditis elegans,
although earlier work with petunia pigmentation genes had raised
the question of how gene addition could apparently lead to reduc-
tion in expression. the process of rnai is thought to have arisen as
rnai works by down-regulating
or ‘silencing’ gene expression by
acting after the mrna has been
transcribed. it is therefore
sometimes called
post-transcriptional gene
silencing.
a defence against viruses and transposons and is triggered by the
presence of double-stranded rna molecules (dsrnas). the term inter-
ference gives some clue as to the functioning of the rnai system. it
refers to what is sometimes called down-regulation (or knockdown)
of gene expression, or gene silencing, which in this case is medi-
ated via short rna molecules that enable speci?c regulation of par-
ticular mrnas. in plants the process is called post-transcriptional
gene silencing. the control of gene silencing by rnai is complex,
but in essence it works by facilitating the degradation of mrna fol-
lowing a sequence-speci?c recognition event. other mechanisms may
prevent translation by antisense rna binding, or may shut off tran-
scription by methylation of bases in the promoter sequence of the
gene.
the mechanism of mrna degradation involves two enzymes,
called dicer and slicer. in the cell, dsrna is recognised by the
dicer enzyme, which processively degrades the dsrna into fragments
around 21 nucleotides in length. these are called short interfering
rnas (sirnas). these associate with a protein complex termed rna
induced silencing complex (risc), which contains a nuclease called
the enzymes involved in
generating short interfering rna
(sirna) have been named ‘dicer’
and ‘slicer’ – appropriate given
their roles in chopping up rna
molecules.
slicer. risc is activated when the dsrna fragment is converted to
single-strand form. the risc complex contains the antisense rna
fragment, which binds to the sense strand mrna molecule. the slicer
nuclease then cuts the mrna and the product is degraded by cellular
nucleases. thus, the expression of the gene is effectively neutralised
by removal of mrna transcripts. an outline of this mechanism of
rnai is shown in fig. 12.7.
in some cases rnai is effected by the synthesis of short rnas from
control genes. these are called micro rnas (mirnas) and are target-
ted by dicer to generate the response and silence the target gene by
either degradation or preventing translation of the mrna transcript.
12.3.2 using rnai as a tool for studying gene expression
as we outlined in chapter 10, many of the methods for studying gene
expression require some knowledge of the gene and its function and
are labour-intensive. with the availability of large-scale dna sequenc-
ing technology, the generation of genome sequence data became a
genome sequencing provides
the information necessary to
investigate gene expression using
rnai methods.
reality. whilst this has provided the sequence information, in most
cases it gives little clue as to the function of a particular (or potential)
gene sequence.
the discovery of rnai presented genome scientists with exactly
the tool that they had been seeking for years the ability to switch246 genetic engineering in action
(a)
(b)
(c)
dsrna
dicer
risc activated risc
sirna
mrna
slicer
(d)
fig. 12.7 rna interference. this is triggered by double-stranded rna (dsrna) as
shown in (a). the rna is cut into pieces about 21 bp in length by the enzyme dicer, as
shown in (b). this generates short interfering rna (sirna), which binds to the risc (c)
and activates it. the complex binds to its complementary sequence in an mrna
molecule (d) and the slicer enzyme cuts the mrna.
off any gene for which the dna sequence was known. by generating
dsrnas that produce antisense riscs for each gene, the effect of turn-
ing off expression of the gene can be investigated. this will enable
researchers to investigate gene expression at the genome level in a
way that was previously impossible, and many groups are already well
on the way to systematically inactivating all the genes in their par-
ticular organism. international co-operation in the provision of the
cloned sequences that generate the dsrnas means that the future
of rnai in investigating gene expression seems assured for years
to come and will provide much useful information on how cells
work.medical and forensic applications of gene manipulation 247
12.3.3 rnai as a potential therapy
one exciting prospect for rnai is in the area of therapeutic applica-
tions. some scientists are a little cautious about expecting too much
too soon, bearing in mind the problems around establishing gene
therapy (as outlined earlier in section 12.2, gene therapy has not yet
delivered proven and reliable treatments). however, many more are
convinced that rnai technology can deliver therapies that can be
adapted to almost any disease that involves expression of a gene or
genes. if the gene can be identi?ed and the sequence-speci?c dsrna
despite some technical
problems, typical of any
developing technology, rnai is
elegantly simple in that the cell
machinery takes over if the
nucleic acid can be delivered to
the correct cells.
introduced into the target cells, then the rnai system should switch
on and result in the knockdown of that particular gene.
as with gene therapy, there are several stages that are critical if a
therapeutic effect is to be realised. the ?rst stage is the preparation
of the nucleic acid that is to be delivered to the target cells. in gene
therapy this is usually a functional gene, which may be problematic
in that genes are often large and complex. in rnai, the dsrna is
much smaller and is likely to pose fewer problems. the next stage
is delivering the nucleic acid to the target cells, which poses sim-
ilar problems to those found in gene therapy. in some cases, direct
injection of dsrnas can be achieved (for accessible tissues), whilst the
problems are much more complex for internal tissues.
assuming the delivery of the dsrna can be achieved, the ?nal
step is effecting the therapeutic action. this is where rnai has great
potential, in that the system should trigger the effect when the dsrna
enters the cell. thus, there is no need for recombination or expres-
sion of a gene sequence, as is the case in gene therapy. a major dis-
advantage is that the effects of rnai in response to a single deliv-
ery of dsrna are transient thus, repeated or continuous delivery
of the therapy is likely to be needed if a long-term bene?t is to be
achieved.
the eye disease age-related macular degeneration (amd) was an
early target for the development of rnai therapy. in this condition,
overpromotion of blood vessel growth in the eye leads to reduction in
visual function of the macula (a sensitive part of the retina). this is
caused by too much of a protein called vascular endothelial growth
factor, which stimulates blood vessel development. thus, the ele-
ments needed for rnai therapy are all present in amd a de?ned
target protein that should be responsive to rnai, a localised tissue
area, and a straightforward delivery method (direct injection). phase
i clinical trials were started in 2004 by the american company acuity
pharmaceuticals, which was the ?rst time that rnai had been deliv-
ered to patients as a potential threapy. phase ii results presented in
2006 appeared promising, and development of this area is continuing
to lead the ?eld of possible rnai-based therapy.
despite the problems associated with rnai as a therapeutic tech-
nology, many in the ?eld think that this is perhaps the best method
that we are likely to have to down-regulate gene expression by a spe-
ci?c and targetted mechanism. in addition to macular degeneration,248 genetic engineering in action
conditions such as diabetic retinopathy, cystic ?brosis, hiv infection,
hepatitis c, respiratory infections, hd, and many others are potential
targets for rnai treatment. there are of course many problems to be
overcome, and it may be dif?cult to devise effective therapies for poly-
genic traits, but optimism remains very high for the development of
rnai as perhaps the most important gene-based therapy in the years
ahead.


المادة المعروضة اعلاه هي مدخل الى المحاضرة المرفوعة بواسطة استاذ(ة) المادة . وقد تبدو لك غير متكاملة . حيث يضع استاذ المادة في بعض الاحيان فقط الجزء الاول من المحاضرة من اجل الاطلاع على ما ستقوم بتحميله لاحقا . في نظام التعليم الالكتروني نوفر هذه الخدمة لكي نبقيك على اطلاع حول محتوى الملف الذي ستقوم بتحميله .
download lecture file topic